Search Specimens

OZCAM (Online Zoo-log-i-cal Col-lec-tions of Aus-tralian Muse-ums) pro-vides access to an online data-base of records aggre-gated from fau-nal col-lec-tions data-bases in Aus-tralian museums.

Occurrence record: BOLD - Australian records - 3020276

Material Sample of Hoplostethus gigas McCulloch, 1914 | Giant Sawbelly recorded on 1998-09-21
   API

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3020276
Other catalog numbers ["recordID:29579;ProcessID:FOA313-04;sampleID:BW-A313"]
Record type Material Sample
Supplied basis "MaterialSample"
Preparations nullnull
Associated Occurrence Status Associated record
Associated occurrences The occurrence is associated with a representative record.
For more information see Inferred associated occurrence details
License CC-BY-Int
Presence/Absence PRESENT
Associated records ASSOCIATED
Occurrence remarks

Event

Occurrence date 1998-09-21
Date precision DAY

Taxonomy

Scientific name Hoplostethus gigas
Identified to rank species
Common name Giant Sawbelly
Kingdom Animalia
Phylum Chordata
Class Actinopterygii
Order Beryciformes
Family Trachichthyidae
Genus Hoplostethus
Species Hoplostethus gigas
Name match metric canonicalMatch
Scientific name authorship McCulloch, 1914
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Western Australia
Latitude -33.3167
Supplied as: "-33.3167"
Longitude 128.417
Supplied as: "128.417"
Datum EPSG:4326
Coordinate precision Unknown
Terrestrial false
Biome MARINE
Marine true
Country Code AU

Additional properties

genbank accession DQ108106
markercode COI-5P
nucleotides CCTATATCTCGTCTTTGGTGCCTGAGCCGGCATGGTCGGCACAGCCTTAAGCCTGCTCATCCGAGCTGAGCTTAGCCAGCCTGGGGCGCTTTTAGGAGACGACCAGATTTATAATGTTATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGCTTTGGAAACTGACTTATTCCTTTAATAATTGGAGCCCCTGACATAGCATTCCCCCGAATAAATAACATGAGCTTTTGACTCCTCCCCCCTTCATTCCTTCTGCTCCTAGCCTCTTCCGGGGTTGAAGCAGGGGCCGGAACAGGATGAACAGTTTACCCACCCCTCGCAGGAAACCTTGCCCACGCAGGGGCCTCCGTAGATCTAACTATCTTCTCCCTACACCTAGCAGGTGTTTCCTCCATTCTAGGGGCCATTAACTTCATTACAACCATCATTAATATGAAACCCCCAGCCATCTCCCAGTATCAGACCCCCTTATTCGTATGAGCCGTTTTAATCACAGCAGTCCTCCTTCTTCTATCCCTCCCCGTTCTTGCAGCCGGCATCACTATGCTCCTTACAGACCGAAACCTAAATACAACTTTCTTTGACCCCGCAGGAGGAGGAGACCCCATCTTATACCAACACCTATTC
Owner institution code Biodiversity Institute of Ontario
sequence last updated 2011-11-14T08:11:24Z

User flagged issues 

    Data quality tests

    Test name Result
    Coordinate uncertainty meters invalid Warning
    Geodetic datum assumed WGS84 Warning
    Name not supplied Warning
    Show/Hide 74 passed properties
    Show/Hide 7 missing properties
    Show/Hide 30 tests that have not been run

    Inferred associated occurrence details

    This record is associated with the representative record. This mean another record has been detected to be similar to this record, and that the other record (the representative record) has the most detailed information for the occurrence. More information about the duplication detection methods and terminology in use is available here:

    Representative Record
    Record UUID 22b37b9c-36b5-4822-aa72-f689e4c962d5
    Data Resource Australian National Fish Collection (ANFC)
    Raw Scientific Name Hoplostethus gigas McCulloch, 1914
    Coordinates -33.31667,128.41667
    Related records
    Record UUID 77e8d075-ecf6-4b1f-b227-9ddca589877f
    Data Resource
    Coordinates -33.3167,128.417
    Record UUID 865f077b-ce15-4d9e-bd10-61dd3d68a1e4
    Data Resource
    Coordinates -33.3167,128.417
    Record UUID fd7355b8-d130-404d-b29b-f27a7871cfe4
    Data Resource
    Coordinates -33.3167,128.417
    Record UUID df415f0e-208e-4960-ad16-598e7ede44e4
    Data Resource Australian National Fish Collection (ANFC)
    Raw Scientific Name Hoplostethus gigas McCulloch, 1914
    Coordinates -33.31667,128.41667
    Record UUID 98c8c771-1196-476c-96c8-dad2cbf5b46b
    Data Resource
    Coordinates -33.3167,128.417
    Record UUID fc604bbc-7ea7-4530-9e3c-5d2d65596941
    Data Resource Australian National Fish Collection (ANFC)
    Raw Scientific Name Hoplostethus gigas McCulloch, 1914
    Coordinates -33.31667,128.41667
    Record UUID 4015bcf2-2ffe-4e8b-b1d9-8311fb20e943
    Data Resource Australian National Fish Collection (ANFC)
    Raw Scientific Name Hoplostethus gigas McCulloch, 1914
    Coordinates -33.31667,128.41667
    Record UUID 3e6e52f5-4b45-413c-b436-fd93a60d7d48
    Data Resource Australian National Fish Collection (ANFC)
    Raw Scientific Name Hoplostethus gigas McCulloch, 1914
    Coordinates -33.31667,128.41667
    Record UUID 76d7fc5c-1eae-4760-bcdd-c5fed072e542
    Data Resource Australian National Fish Collection (ANFC)
    Raw Scientific Name Hoplostethus gigas McCulloch, 1914
    Coordinates -33.31667,128.41667

    Additional political boundaries information

    Area Management
    Australian Coral Ecoregions Recherche Archipelago
    Area management
    National Landcare Program Management Units 2018 Marine NRM
    Biodiversity
    IMCRA 4 Regions Southern Province
    Exclusive Economic Zone Exclusive Economic Zone